Review



t7 promoter  (Integrated DNA Technologies)


Bioz Verified Symbol Integrated DNA Technologies is a verified supplier
Bioz Manufacturer Symbol Integrated DNA Technologies manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 94
      Buy from Supplier

    Structured Review

    Integrated DNA Technologies t7 promoter
    T7 Promoter, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 94/100, based on 644 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t7 promoter/product/Integrated DNA Technologies
    Average 94 stars, based on 644 article reviews
    t7 promoter - by Bioz Stars, 2026-04
    94/100 stars

    Images



    Similar Products

    t7 promoter  (Integrated DNA Technologies)
    94
    Integrated DNA Technologies t7 promoter
    T7 Promoter, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t7 promoter/product/Integrated DNA Technologies
    Average 94 stars, based on 1 article reviews
    t7 promoter - by Bioz Stars, 2026-04
    94/100 stars
    		  Buy from Supplier
    t3 5ʹaattaaccctcactaaaggg 3ʹ promoter tagged pcr fragments  (New England Biolabs)
    98
    New England Biolabs t3 5ʹaattaaccctcactaaaggg 3ʹ promoter tagged pcr fragments
    T3 5ʹaattaaccctcactaaaggg 3ʹ Promoter Tagged Pcr Fragments, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t3 5ʹaattaaccctcactaaaggg 3ʹ promoter tagged pcr fragments/product/New England Biolabs
    Average 98 stars, based on 1 article reviews
    t3 5ʹaattaaccctcactaaaggg 3ʹ promoter tagged pcr fragments - by Bioz Stars, 2026-04
    98/100 stars
    		  Buy from Supplier
    t7 promoter binding sequence  (Addgene inc)
    93
    Addgene inc t7 promoter binding sequence
    T7 Promoter Binding Sequence, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t7 promoter binding sequence/product/Addgene inc
    Average 93 stars, based on 1 article reviews
    t7 promoter binding sequence - by Bioz Stars, 2026-04
    93/100 stars
    		  Buy from Supplier
    t3 5ʹ aattaaccctcactaaaggg 3ʹ promoter tagged pcr fragments  (New England Biolabs)
    98
    New England Biolabs t3 5ʹ aattaaccctcactaaaggg 3ʹ promoter tagged pcr fragments
    T3 5ʹ Aattaaccctcactaaaggg 3ʹ Promoter Tagged Pcr Fragments, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t3 5ʹ aattaaccctcactaaaggg 3ʹ promoter tagged pcr fragments/product/New England Biolabs
    Average 98 stars, based on 1 article reviews
    t3 5ʹ aattaaccctcactaaaggg 3ʹ promoter tagged pcr fragments - by Bioz Stars, 2026-04
    98/100 stars
    		  Buy from Supplier

    Image Search Results